Login / Signup

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence.

Irsyad Ibadurrahmannull SuryaniD Desriani
Published in: Journal, genetic engineering & biotechnology (2023)
This study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.
Keyphrases
  • sars cov
  • loop mediated isothermal amplification
  • respiratory syndrome coronavirus
  • sensitive detection
  • transcription factor
  • coronavirus disease