Sponge gourd ( Luffa cylindrica ) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes ( Rotylenchulus ) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.