A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.