A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

Tahir ZaibWei JiKomal SaleemGuangchen NieChao LiLin CaoBaijun XuKexian DongHanfei YuXuguang HaoYan XueShuhan SiXueyuan JiaJie WuXuelong ZhangRongwei GuanGuohua JiJing BaiFeng ChenYong LiuWenjing SunSongbin Fu

Published in: BMC medical genetics (2019)

Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Keyphrases

early onset
copy number
gene expression
dna methylation
genome wide identification