Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria.

Chen DongJason FontanaAnika PatelJames M Carothers Jesse G Zalatan

Published in: Nature communications (2018)

In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Keyphrases

psychometric properties
crispr cas
genome editing
multiple sclerosis
health information
mass spectrometry
gene expression
genome wide
healthcare
transcription factor
copy number
single molecule
dna methylation
genome wide identification